UNIX: Count poly A. Awk and sed are recommanded...

  • patrick chia
  • Newbie
  • Newbie
  • patrick chia
  • Posts: 5

Post 3+ Months Ago

My input:
AAAAATTTTGGGCCC
AAAAAATT
AAAAAAACCCCCCA
AAAAAAAATTTTTGGGGGCCCCC

My output:
AAAAA = 1
AAAAAA = 1
AAAAAAA = 1
AAAAAAAA = 1

Actually I got use the grep command line to find out the poly A in my input sequence.
The command line I used is:
grep 'AAAAA' inputfiles | wc -l
grep 'AAAAAA' inputfiles | wc -l
grep 'AAAAAAA' inputfiles | wc -l
grep 'AAAAAAAA' inputfiles | wc -l

My senior got advise me to use awk or sed. Any UNIX expert have the idea about use the awk or sed to find out the poly A in my input file? Thanks for all of your advise. Have a nice day.
  • Anonymous
  • Bot
  • No Avatar
  • Posts: ?
  • Loc: Ozzuland
  • Status: Online

Post 3+ Months Ago

Post Information

  • Total Posts in this topic: 1 post
  • Users browsing this forum: No registered users and 113 guests
  • You cannot post new topics in this forum
  • You cannot reply to topics in this forum
  • You cannot edit your posts in this forum
  • You cannot delete your posts in this forum
  • You cannot post attachments in this forum
 
 

© 1998-2014. Ozzu® is a registered trademark of Unmelted, LLC.