How to use UNIX to calculate the total average of bases?

  • patrick chia
  • Newbie
  • Newbie
  • patrick chia
  • Posts: 5

Post 3+ Months Ago

My input is:
>gi|624954|emb|X83528.1|CLPSCD Chlorobium limicola pscD gene
GAAAAGAGGA
>gi|30271926|ref|NC_004718.3| SARS coronavirus, complete genome
ATATTAGGTTTTTAC
>gi|73852470|ref|NC_007346.1| Emiliania huxleyi virus 86
TATATTTAACGCGAATGATT





My desired output:
Total average of bases is: 15

What command line I should type to calculate total average of bases?Thanks for all of your advise. Have a nice day

Post Information

  • Total Posts in this topic: 1 post
  • Users browsing this forum: No registered users and 4 guests
  • You cannot post new topics in this forum
  • You cannot reply to topics in this forum
  • You cannot edit your posts in this forum
  • You cannot delete your posts in this forum
  • You cannot post attachments in this forum
 
 

© 1998-2014. Ozzu® is a registered trademark of Unmelted, LLC.